Interview with Adam Gaertner, Part 2
Here is the second part of our interview with Adam Gaertner, aka @veryvirology on Twitter, which focuses on “very virological” aspects of the pandemic. The interview was done in writing, given the complexity of the subject matter.
IMPORTANT: This interview is for educational purposes only, and not for therapeutic advice. Any and all medical decisions should be decided with you and your physician and any medications or supplements you take should be under the supervision of your physician. Also to be stressed is that the content of the article, which sometimes presents original analysis, needs to be seen as a PrePrint and is not formally peer reviewed.
What’s the importance of virus mutations for fighting COVID-19?
Mostly, until now, they have been quite minimally significant. Many of the mutations that have been hyped – the UK variant, the South African variant, the Brazilian variant – have evolved under weak selection pressure from comprehensive natural immunity. Those mutations have generally just slightly increased their binding affinity for the ACE2 receptor, more efficiently infecting cells, and requiring lower inoculation doses to establish an infection, making them somewhat more transmissible, or presented modified glycan shields, altering some antibody binding sites and mildly raising the likelihood of severe disease. With that said, now that mass vaccination campaigns are underway, the virus is under much stronger selection pressure, brought about by leaky vaccines that do not provide IgA antibody protection. Two kinds of immune evasion are now being observed in wild mutations: antibody evasion and T-cell evasion. These variants are capable of erasing all progress toward herd immunity and entirely restarting the clock on the natural progression of the pandemic. These are the more dangerous variants, and through a process of convergent evolution due to similar pressures being exerted everywhere at once, similar mutations are likely to begin appearing and spreading at rapid rates, in entirely disconnected locations. They are, however, all still treatable with the effective antiviral drugs thus far discovered: ivermectin, bromhexine, hydroxychloroquine/ECGC/quercetin plus zinc, artemisinin, and potentially colchicine, to name a few.
What’s the importance of the recently published research by Agerer et al?
I glossed over some of the details in my previous writeup, for the sake of non-expert readability, at the cost of technical accuracy. Answering this more fully requires a deeper dive into the function and polymorphism of the MHC/HLA complex. There are two components to the HLAs; the polymorphic antigen binding grooves (ABGs), which function like locks to the viral peptides’ keys, and the highly conserved structural regions, which form the larger structure of the protein, and allow it to perform various necessary functions for binding and cell surface presentation of viral peptides. In the course of ordinary mutation, a mutated peptide may cease to fit in the ABG of a given HLA, and it may end up fitting into a different one instead. The vast polymorphism in across the human population ensures that a single mutation, even if unrecognizable and thus deadly to one individual, will never become a population-level threat, as the extraordinarily diverse selection of ABGs ensures that there’s a good chance that most of the rest of the population will still be able to bind it. However, very unusually, ABGs are not the primary concern here. They are of concern; MHC-I limits selection of antigenic peptides to a few candidates with high binding affinity, out of the thousands presented by proteosome protein degradation, and the emergence of inhibitory mutations in otherwise highly selectable peptides represents a significant blow to the protection provided by population-level polymorphism, but the apparent destruction of the HLA tetramer by these mutants presents an even more pressing issue.
In Agerer et al, mutant, and separately wild-type, SARS-CoV-2 peptides were loaded into HLA-A02:01 and HLA-B40:01 proteins at low temperature. These HLAs were selected as they were possessed of the correct ABG to bind the relevant peptides, which was demonstrated as both mutant and wild-type peptides were successfully bound to the HLAs. However, when raised to body temperature, 37°C, the HLAs bound to the mutant peptides structurally disintegrated, resulting in non-existent T-cell binding. While determining the precise method by which the HLA was disintegrated would require some very powerful protein folding calculations, this outcome is sufficiently indicative of a larger problem: rather than evading a specific ABG, the mutant peptides have structurally destroyed the MHC-I tetramer. This amounts to an evolutionary gain of function that will likely be preserved and selected for across multiple hosts, providing complete immune cloaking against MHC-I and CD8 detection regardless of HLA ABG polymorphism.
Why do you think there is a likely link between the vaccines and the identified mutations?
I should first note that Agerer et al explicitly mentioned that no inferences regarding the cause or source of these mutations should be drawn directly from their work. A causative link is not firmly established or proven, but it is probable. To begin explaining the impact of selection pressure on genomic mutations, we must start with a discussion of mutation events.
Single-nucleotide mutation events are quite common. These are random mutations that substitute a single nucleotide for another, and can occur at any loci within a genome. Single-nucleotide mutation events may or may not be preserved; if the mutation affects reproductive fitness positively, or has no effect, it is far more likely to be retained over further reproductive cycles than one that negatively affects reproductive fitness. Single-nucleotide mutations will most commonly have little or no impact alone, and thus can often accumulate until an entire codon – a group of three nucleotides which determines the amino acid to be translated at that point in the genome – is affected, which is then more likely to have a significant impact on the fitness of the organism. However, the randomness of such mutations across the entire genome, and the fact that the extant genome as-is has already obtained reproductive fitness, means that the chance of substitutions occurring in three consecutive nucleotides, in the absence of selection pressure, over a short period of time, is highly unlikely. Even less likely is an evolutionarily unrelated genome making an identical substitution.
Now, the discussion turns to the mechanics of leaky vaccines, with a contrast to the functioning of a normal, naïve immune system.
In the course of natural infection of a naïve host, the immune system is starting from zero, with the exception of polymorphic HLAs capable of binding a wide range of peptides that have been recognized and remembered across millions of years of evolution. The strain that initially infects the host is perfectly capable of reproducing and spreading within the host, and so selection pressure is minimal; in one potential course of infection, the innate immune system, and potentially the complement system, will first recognize signs of an infection and recruit various innate immune cells to begin fighting it; antigens will be presented, adaptive immunity will develop, and within a relatively brief period, all the branches of the immune system will work together to eradicate the pathogen. This occurs quickly enough that significant mutations do not have the time to accumulate, and the infection is cleared. A highly active innate immune response is crucial to mounting this comprehensive defense.
With a fully functional vaccine that includes IgA, IgG and IgM immunity, the pathogen is arrested in the mucosa before significant infection can take root, and the rest of the immune system may barely take notice at all.
With leaky vaccines, however, we are starting at the halfway mark. IgA immunity is minimal or absent, not even being measured by the major trials, but IgG and IgM immunity are primed and ready to go, meaning that a virus may succeed in initial infection, but will be unable to spread very far through the blood. With a strong humoral immune response, serum macrophages are easily capable of phagocytosing free virions, and levels of cytotoxic effector cells and inflammatory cytokines remain very low, significantly reducing superficial symptoms of infection. However, this comes with a tradeoff: free virions are quickly consumed, but infected cells take significantly longer to destroy due to lower levels of active innate immune cells and cytotoxic T-cells. Ordinarily, other aspects of the cytosolic immune system, via cytokine signaling and protein kinase activity, would alleviate this problem, and still effect clearance within a reasonable time span. In light of pre-existing interferon, MHC-I and MHC-II suppression functions, this process is significantly delayed and provides an unnaturally long time period of cytosolic replication within which mutations may rapidly accumulate.
The fact that serum antibodies are quick to attach to their recognized viral antigens applies a very strong selection pressure; when a mutation emerges that is capable of evading those antibodies, that mutation will then be capable of much broader infection, and will quickly surpass the previous variants in number and reproductive success. This is the process of evolutionary escape.
Now, we can turn back to the issue at hand: SARS-CoV-2 evolutionary escape from CD8. Two, among 11, of the isolated peptides are analyzed. Reverse FASTA protein sequence analysis based on E.coli ribosomal output is used here to translate identified peptides into nucleotide sequences. Each of the two peptides have two variants; wild-type, and the isolated mutant type. The protein sequences are YFQPRTFLL (wild) versus YLQPRTFLL (mutant), and LFFNKVTLA (wild) versus LLFNKVTLA (mutant). Each has only a single amino acid substitution, both in the second position, constituting the mutation of one consecutive triplet.
The translated RNA sequences are as follows:
YFQPRTFLL – YLQPRTFLL
tattttcagccgcgcacctttctgctg
tatctgcagccgcgcacctttctgctg
LFFNKVTLA – LLFNKVTLA
ctgttttttaacaaagtgaccctggcg
ctgctgtttaacaaagtgaccctggcg
The SARS-CoV-2 virus is known to accumulate only, approximately, two single nucleotide mutations per genome month, in random locations, across a genome approximately 30,000 nucleotides long. For three nucleotide mutations to occur, sequentially, independently, at precisely the same loci and in contemporaneously isolated samples from different infected patients, is extraordinarily unlikely to occur a) at all, given the ordinary time constraints on accumulation of mutations, and b) without extraordinary selection pressure concentrating those preserved mutations on that loci, which appears to have resulted in the inactivation of the MHC-I tetramer upon otherwise successful peptide binding.
It is thusly that I draw my conclusion, that these mutations are highly likely to have evolved due to the selection pressure and relaxed time constraints imposed upon a viral infection by a leaky vaccine.
I should also note that the immune escape pathway and process described above has only tangenital relation to the immune escape process being described by Dr. Vanden Bossche, who to my understanding is focused largely on the dangers of inadequate humoral immunity. These are both serious, but largely distinct issues.
Among the existing C19 vaccines, are there any you are comfortable with?
I do not believe there are any that I am inclined to take at this time. If and when there appears to be a comprehensive, safe vaccine that provides protection against infection and transmission, I will give such a vaccine serious consideration. Some of the oral vaccines, if early results are replicated, appear to be providing comprehensive immunity against initial infection, and may thus be actually useful in moving us towards herd immunity.
See Part 1:
